logo
 

Duplicação, transcrição e tradução gênica

  • A genética molecular procura explicar como a informação hereditária se organiza e se manifesta nos organismos vivos. Hoje sabemos que os genes são feitos de DNA e que a sua expressão fenotípica ocorre na forma de moléculas de RNA, que são traduzidos em peptídeos. Assim, quando nos referimos ao gene A, B, ou C, normalmente queremos dizer que esses segmentos codificam um peptídeo A, B ou C que irá exercer alguma função dentro da célula ou no organismo. Por outro lado, quando falamos em alelo A¹, A² ou a, isto significa que o gene A é capaz de – por meio de seus diferentes alelos – codificar um mesmo peptídeo com pequenas diferenças em sua composição de aminoácidos.Essas diferenças podem resultar em alterações no funcionamento ou na expressão desses peptídeos, o que pode acabar modificando o fenótipo dos indivíduos. Sendo assim, esse capítulo tem por função mostrar como a informação contida na molécula de DNA é transformada em ação (o fenótipo) dentro e fora das células.
expressao


Exercício 1 - a duplicação do DNA:

A duplicação dos cromossomos dos eucariotos começa em vários pontos da molécula de DNA, com a ação de enzimas helicase e girase separando a dupla fita e levando a formação de várias "bolhas de replicação", conforme exemplificado abaixo:

bolha_replicacao

  • Como pode ser observado, cada bolha tem duas forquilhas de replicação, uma que segue para a esquerda e a outra para a direita. Sendo assim, determine como a replicação do DNA se dá em cada forquilha de replicação, tendo em vista as diferentes situações apontadas abaixo:
    • O por quê da necessidade de primers ou iniciadores para o início da duplicação do DNA: as enzimas de síntese de DNA, chamadas DNA polimerases, não conseguem iniciar produção de uma nova fita dessa molécula usando apenas o molde monofilamentar de DNA (uma das fitas abertas). Nesse caso, também é necessário que, aderido a esse molde, exista um pequeno segmento de RNA chamado primer ou iniciador - sintetizado por uma RNA polimerase (ou, nesse caso, por uma primase) - e que oferece uma extremidade 3´-OH livre para que a DNA polimerase continue o processo de duplicação dessa nova fita. Posteriormente, esse primer é retirado e substituído por DNA:
duplicacao
(A) Abertura da forquilha de replicação, (B) Síntese do primer pela primase e (C) Extensão da síntese de cada fita pela DNA polimerase.

    • A direção de síntese da nova fita de DNA e o fato das duas fitas moldes correrem em sentido antiparalelo: além de necessitar de uma fita molde e de um primer, a DNA polimerase somente consegue sintetizar uma nova molécula de DNA acrescentando novos nucleotídeos ao carbono 3´do açúcar (o carbono 5´ fica localizado na parte oposta a esse açúcar). Por isso se diz que a síntese dos ácidos nucléicos ocorre no sentido 5´ 3´. Como cada fita da molécula de DNA corre em sentido inverso, a sua duplicação ocorre em direções opostas. O esquema abaixo mostra o sentido da duplicação em apenas uma das fitas da molécula de DNA:
replicacao

    • O por quê de uma das fitas ser chamada de lagging (lenta) e a outra de leading (rápida): pelo fato da molécula de DNA ser formada por duas fitas que correm em sentido antiparalelo, durante a abertura da forquilha de replicação, um dos filamentos vai sendo aberto no sentido  5' 3'  e o outro no sentido 3' 5'. Assim, embora a progressão da síntese dessas duas fitas aconteça simultaneamente, a medida em que essa forquilha é extendida, em uma delas a DNA polimerase sempre terá uma extremidade 3´-OH livre para colocar o próximo nucleotídeo (a fita leading). Na outra, de tempos em tempos, será necessária a síntese de um novo primer, para que ela possa continuar esse processo (a fita lagging), conforme pode ser observado no esquema abaixo:
duplicacao_animada

Considerando o modelo de replicação nas bactérias, no modelo acima, a sequência amarela representa o primer (RNA) sintetizado pela enzima primase e a sequência em azul representa a nova fita de DNA produzida pela DNA polimerase III à medida em que a molécula molde de DNA vai sendo aberta. Observe que a direção de síntese da nova molécula de DNA se dá no sentido 5´ 3´. Assim, na fita de cima a duplicação continuará acontecendo de maneira contínua (a fita leading). Por outro lado, na fita de baixo (a fita lagging), um novo primer deverá ser sintetizado mais à frente.

    • O significado da existência dos fragmentos de Okazaki: como vimos, um dos novos filamentos de DNA é sintetizado continuamente pela DNA polimerase III; o outro, precisa ser sintetizado em partes. Fragmentos de Okazaki são justamente os trechos curtos de primer + DNA (com cerca de 100 a 200 nucleotídeos, nos eucariotos) produzidos temporariamente na fita de replicação descontínua.
Fragmento de Okazaki
    • Logo em seguida, os primers são removidos de ambas as fitas pela DNA polimerase I (a seta em vermelho do esquema abaixo) que, ao mesmo tempo, vai completando a síntese da fita de DNA no trecho liberado. Por fim, os filamentos adjacentes de DNA  são unidos via ligação covalente pela DNA ligase (o triângulo amarelo que aparece no esquema abaixo).
duplicacao



Exercício 2 - a transcrição do DNA em RNA:


O mecanismo de transcrição do DNA em RNA:
  • As moléculas de ácidos nucleicos (DNA e RNA) somente conseguem se parear se estiverem em sentidos opostos. Esse sentido é dado pela posição dos carbonos 5' e 3' da pentose (desoxiribose no DNA e ribose no RNA) presente nessas moléculas, como pode ser observado no esquema apresentado abaixo:
DNA
  • Isso vale para as duas fitas de uma molécula de DNA (por isso se diz que as duas fitas dessa molécula correm em sentido antiparalelo), para as associações DNA-RNA, que ocorrem, por exemplo, durante a transcrição, ou RNA-RNA, que ocorrem, por exemplo, durante a tradução, entre moléculas de RNAs mensageiros e RNA transportadores.
  • Além disso, a síntese de novas fitas de ácidos nucleicos, quer seja DNA ou RNA, somente ocorrem no sentido 5´ → 3´. Portanto, a fita que lhe serve de molde deve correr em sentido oposto (3´ ← 5´). Assim, se formos considerar o processo de duplicação do trecho de DNA abaixo, este se dará da seguinte forma:
duplicacao



Exercício 3 - A transcrição e a tradução:

A figura abaixo mostra um mesmo trecho de DNA, só que em cada uma das situações o sítio de início e de término da transcrição se encontram em posições distintas:
transcricao
  • O que significam os termos promotor e finalizador desse esquema? Quais seriam as funções dessas sequências que estão presentes nas moléculas de DNA?
    • O sítio promotor é a região da molécula de DNA que informa o local em que um determinado gene se origina. O sítio promotor é composto por sequências específicas de nucleotídeos que são reconhecidas pelas enzimas responsáveis pela síntese de RNA. É depois dessa sequência que uma molécula de RNA começa a ser sintetizada. Por outro lado, a região finalizadora contém uma sequência nucleotídica também específica, que indica onde a transcrição da molécula de RNA deverá ser encerrada. O esquema abaixo exemplifica o processo de transcrição bacteriano:
transcrição


  • Determine quais serão as sequências transcritas das moléculas de RNA mensageiros (RNAm) para essas duas sequências. Não se esqueça de marcar as suas respectivas extremidades 5' e 3'. 
      • Na situação hipotética A, a transcrição se dará da seguinte forma:
REPLICACAO

          • Esta resultará na seguinte molécula de RNA mensageiro (ou RNAm):
5´ - AUGGCCGGAUCGGUGGGGCAU - 3'

      • Na situação hipotética B, a transcrição se dará da seguinte forma:
REPLICACAO

          • Esta resultará na seguinte molécula de RNA mensageiro (ou RNAm):
3´ - UACCGGCCUAGCCACCCCGUA - 5'



  • Utilizando a tabela do código genético disponível abaixo, determine como seria a sequência peptídica codificada por cada um dos dois RNAm produzidos nessas duas situações.
    • Devemos prestar atenção ao fato que toda molécula de RNAm que chega em um ribossomo para a tradução gênica sempre começará a ser lida pela sua extremidade 5´. Portanto, a fita de cima deverá ser lida da esquerda para a direita e, a fita de baixo, da direita para a esquerda.
    • A sequência de uma molécula de mRNA é lida de 3 em 3 nucleotídeos, de uma maneira não sobreposta. Ou seja, cada trinca de nucleotídeos, também chamada de códon, é lida uma única vez. E existe ao menos um códon específico para cada um dos 20 aminoácidos comumente encontrados nos peptídeos.
    • Usando a tabela do código genético para traduzirmos esses trechos, descobrimos que esses dois RNAs nos fornecerão as seguintes sequências peptídicas:
traducao

traducao


  • Colocando os peptídeos formados, lado a lado, podemos perceber que eles não terão a mesma sequência peptídica:
    • Situação hipotética A: Met-Ala-Gly-Ser-Val-Gly-His
    • Situação hipotética B: Met-Pro-His-Arg-Ser-Gly-His


TABELA DO CÓDIGO GENÉTICO:

Tabela codigo genetico

  • Por que as sequências peptídicas não são idênticas se o trecho de DNA transcrito foi o mesmo?
    • Isso acontece porque as duas fitas da molécula de DNA não são iguais, mas sim complementares. Ou seja, se em uma das fitas temos uma adenina, na região correspondente da outra fita teremos que ter uma timina, e assim por diante. Por esse motivo é que as regiões promotoras dos genes são importantes. Elas informam para as enzimas envolvidas no processo de transcrição não apenas o ponto exato em que a síntese da molécula de RNA deverá ser iniciada, mas também qual das duas fitas do DNA deverá servir de molde para isso. Por sua vez, essa fita de RNA irá codificar um peptídeo específico, que pode ser uma enzima, um hormônio, uma proteína de membrana, uma proteína de defesa, e assim por diante.


Exercício 4 - A transcrição e a tradução:

Considerando os diferentes códons dos mRNA dados a seguir, indique como seria a sequência da molécula de DNA que lhe deu origem, quais seriam os respectivos anticódons do tRNA que se ligariam a esses códons, bem como o aminoácido a ser incorporado no peptídeo:

traducao
  • Como temos apenas a sequência do RNA mensageiro, podemos começar determinando a sequência da fita de DNA que lhe serviu de molde (A). Tendo em vista que o mRNA desse exemplo corre no sentido 5´→3´, a fita de DNA que lhe serviu de molde tem que ser aquela que corre no sentido 3´→5´. Também devemos nos lembrar sobre a necessidade de complementariedade entre as bases do DNA/RNA. Ou seja, para termos uma adenina no mRNA, o DNA precisa ter uma  timina, e assim por diante. Lembrando que nos RNAs a timina é substituída pela uracila. Nesse último caso, se no mRNA foi incorporada uma uracila, é por que no DNA molde havia uma adenina.

Traducao

  • Nesse exemplo também já podemos determinar a sequência de aminoacidos do peptídeo (B). Lembrando que a sequência de nucleotídeos do mRNA (os códons deste) é quem determina a sequência peptídica. Feito isso, podemos determinar a sequência da fita complementar da molécula de DNA (C) e da sequência do anticódon do tRNA (D), que é a região do tRNA que permite o seu pareamento com o códon do mRNA. Novamente, sempre pensando no fato que essas bases precisam ser complementares (G=C e A=T se for DNA, ou G=C e A=U se for entre RNAs, conforme é mostrado pelas setas verdes):
Traducao





Num organismo, um loco hipotético apresenta a sequência nucleotídica abaixo:

Traducao

Diante dessas informações, responda:
  • Com relação especificamente a esse trecho, como será a sequência de bases na molécula de pré RNA mensageiro (hnRNA)?
    • O hnRNA ou pré-RNA mensageiro é encontrado em eucariotos. Nesses organismos, os genes são normalmente compostos por dois tipos de sequências nucleotídicas. Uma delas, chamadas de íntrons, serão retiradas logo após a transcrição; as outras, chamadas de éxons, normalmente permanecerão no RNA mensageiro maduro, e servirão de molde para codificar a sequência peptídica nos ribossomos.
    • Considerando que nesse esquema, o sítio promotor se encontra à esquerda, o hnRNA deverá ter a seguinte sequência:
Traducao
          • Observação: os nucleotídeos na área em vermelho representam os trechos lidos dos éxons e os na área em azul, os dos íntrons.

  • Depois que o hnRNA mensageiro for processado, qual será a sequência resultante do RNA mensageiro (mRNA)?
    • Depois de sintetizado esse hnRNA normalmente sofre uma série de modificações. Uma delas envolve a retirada dos íntrons (os trechos em azul), resultando na seguinte sequência codificadora no mRNA maduro:
Traducao

  • Qual será a sequência de aminoácidos codificada por esse RNA mensageiro processado?
    • Depois de pronto, o mRNA segue para o citoplasma, onde será traduzido nos ribossomos, a partir da sua porção 5', na seguinte sequência peptídica:
traducao



A figura animada abaixo representa o processo de tradução de um RNA mensageiro:

Traducao

Legenda:

Legenda